Control of bacterial nitrate assimilation by stabilization of G-quadruplex DNA

G-quadruplexes are nucleic acid secondary structures formed from guanine-rich sequences, and comprise a planar arrangement of four guanines that are stabilized by Hoogsteen hydrogen bonding and cations. These structures have been widely implicated in the control of gene expression for a number of eukaryotic systems. Stabilization of G-quadruplex has been shown to modulate the level of gene expression at both the transcriptional and translational level and can lead to cell senescence and apoptosis via disruption of the shelterin complex and inhibition of telomerase in cancer cells. Despite a number of G-quadruplex sequences being predicted in the genomes of a range of bacteria, so far limited progress has been made in evaluating the breadth of G-quadruplex function in gene regulation and metabolism. The Gram-negative soil bacterium Paracoccus denitrificans PD1222 exhibits a high degree of metabolic flexibility and may use a range of inorganic nitrogen (N) sources, including nitrate (NO3 ), nitrite (NO2 ) and ammonium (NH4 ) to support anabolic cellular processes. For growth with NO3 and/or NO2 , expression of regulatory (nasTS) and structural genes (nasABGHC) for the assimilatory NO3 -reductase (Nas) system are required. Here, nasT plays a pivotal role in encoding the activator component of the NO3 -responsive regulatory complex NasS–NasT, without which the bacterium is unable to grow with NO3 , but retains the capacity to grow with NH4 , as a sole N-source. Given that P. denitrificans has high genomic G+C content, approx. 67%, we decided to investigate whether G-quadruplex structures influenced bacterial growth on inorganic N-sources. A genome-wide analysis of P. denitrificans PD1222, using the Quadparser programme, revealed the 1.4 Mb genome was predicted to contain 494 putative G-quadruplex forming sequences. One 21 nucleotide sequence tract, 50-GGGAGCGGGACGGGGGCCGGG-30, predicted to form a canonical G-quadruplex, lies in the intergenic region 150 nt upstream of nasT. Therefore, G-quadruplex formation in DNA at this site may influence expression of the NasT protein, the essential positive regulator for NO3 -dependent growth. Firstly, to test whether the putative sequence identified adopted G-quadruplex structure in vitro, a combination of ultraviolet (UV) melting, UV difference and circular dichroism (CD) spectroscopies were used to probe the conformation and stability of the DNA. All experiments were performed using the single-stranded 50-d(GGGAGCGGGACGGGGGCCGGG)-30 oligonucleotide (termed nasT 0) in 10 mM sodium cacodylate buffer (pH 7.4), supplemented with 100 mM of additional stabilizing cations (KCl, NaCl, LiCl or NH4Cl). Given that DNA structures absorb UV light differently when folded or unfolded, difference spectra can be used to readily identify various DNA secondary structures formed in solution. Importantly, the presence of intramolecular G-quadruplex structures in a sample can also be inferred by the shape of UV thermal difference spectra (TDS). UV spectra of nasT 0 were measured at 20 1C and 80 1C with selected cations present to reveal the TDS in different cationic environments. In the presence of KCl, the difference spectrum exhibited positive maxima at 244 and 273 nm, a shoulder at 255 nm, and a negative minimum at 295 nm (Fig. 1A), comparable to other well-characterized G-quadruplexes. The TDS in the presence of Na also showed similar features but those in Li were less well defined and in the presence of NH4 + these features were minimal, indicating low populations of folded G-quadruplex in solution. Thermal denaturation experiments monitored at 295 nmdisplayed superimposablemelting and cooling profiles (Fig. S1, ESI†), consistent with fast and reversible formation of intramolecular G-quadruplex species. Notably, melting transitions were independent of oligonucleotide concentration, also consistent with intramolecular G-quadruplex formation. a School of Pharmacy, University of East Anglia, Norwich Research Park, NR4 7TJ, UK. E-mail: [email protected] b School of Biological Sciences, University of East Anglia, Norwich Research Park, NR4 7TJ, UK. E-mail: [email protected] † Electronic supplementary information (ESI) available. See DOI: 10.1039/c6cc06057a Received 22nd July 2016, Accepted 20th October 2016